Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Endovascular treatment of ruptured lobulated anterior communicating artery aneurysms: A retrospective case series study of 24 patients / 国际脑血管病杂志

Objective:To investigate the efficacy and safety of endovascular treatment for ruptured lobulated anterior communicating artery aneurysm (ACoAA).Methods:Patients with ruptured lobulated ACoAA received endovascular treatment in Sanming First Hospital Affiliated to Fujian Medical University from June 2020 to June 2022 were retrospectively included. Their demographic, clinical and imaging characteristics, endovascular treatment methods and follow-up results were collected.Results:A total of 24 patients with ruptured lobulated ACoAA were included, including 9 males (37.5%) and 15 females (62.5%). Their age was 56.2±8.9 years old (range 39-74). The time from rupture to endovascular treatment was 10.9±12.5 h. The maximum diameter of the aneurysms was 5.1±1.0 mm and neck width was 3.0±0.7 mm. Nineteen patients (79.2%) were double-lobed and 5 (20.8%) were multilobed. Fisher's grade: grade 2 in 16 cases (66.7%), grade 3 in 6 cases (25%), and grade 4 in 2 cases (8.3%). Hunt-Hess grade: grade 0-2 in 5 cases (20.8%), grade 3-5 in 19 cases (79.2%). Glasgow Coma Scale score: 9-12 in 14 cases (58.3%), 13-15 in 10 cases (41.7%). Immediately postprocedural Raymond-Roy grade: grade 1 in 23 cases (95.8%), grade 2 in 1 case (4.2%). Raymond-Roy grade in imaging follow-up for 2 weeks to 3 months: grade 1 in 23 cases (95.8%), grade 2 in 1 case (4.2%). Follow-up for 2 to 12 months showed that 21 patients (87.5%) had good functional outcomes (modified Rankin Scale score ≤2), and there were no deaths.Conclusion:Endovascular treatment is a safe and effective treatment for ruptured lobulated AcoAA.

Risk Factors of Hypogonadism in Male Patients with Hyperuricemia in Xinjiang / 中山大学学报(医学科学版)

ObjectiveTo explore the risk factors of hypogonadism in male hyperuricemia （HUA） patients in Xinjiang. MethodsClinical data of 217 male patients with HUA admitted to the Department of Endocrinology and Metabolism of the People's Hospital of Xinjiang Uygur Autonomous Region from June 2021 to December 2022 were collected. Patients meeting the diagnostic criteria for hypogonadism were included in the case group （98 cases）， and patients with normal gonadism were included in the control group （119 cases）. The differences of different metabolic indexes between the two groups and the correlation of male hypogonadism were analyzed. ResultsCompared with those in normal gonadal function group， in hypogonadism group， age， waist circumference （WC）， body mass index （BMI）， the levels of fasting blood glucose （FPG）， fasting insulin （FINS）， insulin resistance index assessed by homeostasis model （HOMA-IR）， alanine aminotransferase （ALT）， blood uric acid （SUA） and sex hormone binding globulin （SHBG） were significantly increased； the levels of γ-glutamyltransferase （GGT）， 25-hydroxyvitamin D ［25（OH）D］， progesterone （P）， estradiol （E2）， dehydroepiandrosterone （DHEA） and serum free triiodothyronine （FT3） were significantly decreased （P < 0.05）； and the proportion of patients with obesity （OB）， non-alcoholic fatty liver （NAFLD）， hyperlipidemia （HLP）， hypertension （HBP）， coronary heart disease （CHD） and use of angiotensin receptor antagonist （ARB） and aspirin was significantly increased （P < 0.05）. Correlation analyses showed that free testosterone （FT） was negatively correlated with age， WC， BMI， FPG， FINS， HOMA-IR， SUA， SHBG and ALT， but positively correlated with 25（OH）D， P， E2， DHEA and FT3 （P < 0.05）. Logistic regression analysis showed that age， hypertension， BMI， SUA， ALT， 25（OH）D， HOMA-IR and WC were independent risk factors for hypogonadism （P < 0.05）. After multivariate adjustment， SUA remained an independent risk factor for hypogonadism ［OR = 1.009， 95%CI （1.004， 1.015）， P = 0.001］. ConclusionsMale HUA patients are often accompanied with hypogonadism. Age， hypertension， BMI， SUA， ALT， 25（OH）D， HOMA-IR and WC are independent risk factors of hypogonadism.

Predictive value of serum lactate dehydrogenase on prognosis of patients with paraquat poisoning / 中华劳动卫生职业病杂志

Objective: To investigate the predictive value of serum lactate dehydrogenase (LDH) in the prognosis of patients with paraquat (PQ) poisoning, and to provide evidence for early prognosis assessment. Methods: In February 2022, 50 patients with PQ poisoning who completed serum LDH detection admitted to the Department of Emergency Medicine, the First Affiliated Hospital of Wenzhou Medical University from January 2012 to December 2021 were selected as the observation group, and 50 healthy physical examination personnel were randomly selected as the control group. Patients with PQ poisoning were divided into survival group and death group according to the prognosis, and the differences of blood routine routine, liver and kidney function and other indicators in the first admission between the two groups were compared. Multivariate logisitic regression model was established, ROC curve was drawn, and the influencing factors of prognosis of patients with PQ poisoning were analyzed. Results: Compared with the control group, the white blood cell count (WBC), total bilirubin (TBil), alanine aminotransferase (ALT), aspartate aminotransferase (AST), LDH, glucose (GLU) and creatinine (Cr) in observation group were significantly increased, while albumin (ALB) and total cholesterol (TC) were significantly decreased (P<0.05). Univariate analysis showed that WBC, elevated LDH (>247 U/L), TBil, ALT, AST and Cr were significantly different between PQ poisoning survival group and death group (P<0.05). Multivariate logisitic regression analysis showed that elevated serum LDH was an independent risk factor for the prognosis of PQ poisoning patients (OR=9.95, 95%CI: 1.34-73.82, P=0.025). The area under the ROC curve of LDH was 0.811 (95%CI: 0.692-0.930). When the cut-off value was 340 U/L, the sensitivity was 0.889 and the specificity was 0.719. Log-rank test showed that there was a statistically significant difference in survival rate between the normal LDH group and the elevated LDH group (P=0.001) . Conclusion: Serum LDH has a good predictive value in evaluating the prognosis of patients with PQ poisoning. Elevated LDH is a risk factor for poor prognosis of patients with PQ poisoning.

Causal links between long-term exposure to NO2 and the risk of cardiovascular hospitalization / 中华流行病学杂志

Objective: To determine the causal association between long-term Nitrogen dioxide (NO2) exposure and the risk of cardiovascular hospitalization. Methods: Based on a sub-cohort of a community-based prospective cohort study, a total of 36 271 participants were recruited from 35 communities randomly selected in Guangzhou in 2015. The annual average exposure of NO2, demographic characteristics, lifestyle factors, and information on the causes of hospitalization was collected. We applied marginal structural Cox models to investigate the effect of NO2 on cardiovascular hospitalization. Demographic and behavioral factors also stratified results. Results: The mean age of participants in the present study was (50.9±17.8) years, and the cardiovascular admission rate was 8.7%, with 203 822 person-years of follow-up. The annual mean NO2 concentration was 48.7 μg/m3 during 2015-2020. For each 10 μg/m3 increase in NO2 concentrations, the HRs (95%CIs) of total cardiovascular hospitalization, cardiovascular hospitalization, and cerebrovascular hospitalization were 1.33 (1.16-1.52), 1.36 (1.16-1.60) and 1.25 (1.00-1.55), respectively. Participants who were never married/married, with secondary education, high exercise frequency, or non-smokers/current smokers may be more susceptible than their counterparts. Conclusion: Long-term exposure to NO2 significantly increased hospitalization risk for cardiovascular disease.

Improvement of China's legal system for public health emergency management from the perspective of lifecycle management / 中华流行病学杂志

A crucial lesson gained through the pandemic preparedness and response to COVID-19 is that all measures for epidemic control must be law-based. The legal system is related not only to public health emergency management per se but also to all aspects of the institutional supporting system throughout the lifecycle. Based on the lifecycle emergency management model, this article analyses the problems of the current legal system and the potential solutions. It is suggested that the lifecycle emergency management model shall be followed to establish a more comprehensive public health legal system and to gather the intelligence and consensus of experts with different expertise, including epidemiologists, sociologists, economists, jurist and others, which will collaboratively promote the science-based legislation in the field of epidemic preparedness and response for the establishment of a comprehensive legal system for public health emergency management and with Chinese characteristics.

Treatment of neovascular glaucoma by anti-vascular endothelial growth factor combined with ultrasonic ciliary plasty / 国际眼科杂志(Guoji Yanke Zazhi)

AIM: To investigate the clinical efficacy and safety of ultrasonic ciliary plasty(UCP)combined with injection of anti-vascular endothelial growth factor(VEGF)in the treatment of neovascular glaucoma(NVG).METHODS: A total of 30 NVG patients(30 eyes)admitted to the First Affiliated Hospital of Bengbu Medical College from September 2020 to September 2021 were selected. After admission, all the eyes of the patients were injected with anti-VEGF drug(ranibizumab). After surgery, 15 patients were randomly selected for UCP treatment(UCP group), and the other 15 patients received trabeculectomy(trabeculectomy group). During the 10mo postoperative follow-up, the decrease of intraocular pressure was compared between the two groups and the changes of the degree of ocular pain and the occurrence of related complications were evaluated at each follow-up visit.RESULTS: The intraocular pressure and pain degree of the UCP and trabeculectomy groups were significantly lower than those before operation, and the complication probability of the UCP group was less than that of the trabeculectomy group.CONCLUSION: With fewer complications and high safety, UCP combined with anti-VEGF injection can effectively control intraocular pressure and pain in NVG patients.

Recent advances in small molecule inhibitors of interleukin‑1 receptor-associated kinase / 药学学报

Interleukin-1 receptor associated kinase 4 (IRAK-4), acting as a serine threonine kinase, is considered as a key signal node for the transduction of IL-1R family and TLRs signal pathway. Studies have found that IRAK-4 has a hand in many signal pathways, involving the inflammatory response of human joints, intestines, liver and nervous system, as well as other autoimmune diseases. It is also one of the causes of drug resistance of some cancer cells. Therefore, IRAK-4 tends to be an effective therapeutic target for inflammatory diseases and cancer. The prospects for the development of drugs in this pathway is to develop novel IRAK-4 small molecule inhibitors and investigate their safety and effectiveness, enrich the clinical treatment of inflammatory and cancer diseases finally. This paper classified and summarized the latest research progress on small molecule inhibitors of IRAK-4 signaling pathway according to structures of the compounds, in order to provide assistances and references for the research and development of related drugs.

Effects of stereoscopic traction on photosynthetic characteristics, yield, and quality of Codonopsis pilosula under organic cultivation / 中国中药杂志

To solve the serious problem of stem and leaf shading in the middle and late stage of traditional flat planting of Codonopsis pilosula, this study analyzed the effects of different stereoscopic traction heights on the photosynthetic characteristics and growth of C. pilosula and explored the optimal traction height to improve the yield and quality of C. pilosula. The experiment designed three stereo-scopic traction heights [H1(60 cm), H2(90 cm), and H3(120 cm)] with natural growth without traction as the control(CK). The results showed that the increase in stereoscopic traction heights broadened the growth space of stems and leaves of C. pilosula, enhanced the ventilation effect, significantly increased the average daily net photosynthetic rate of C. pilosula, promoted the absorption of intercellular CO_2, decreased the transpiration rate, and reduced the evaporation of water. Moreover, it effectively avoided the problem of weakened photosynthesis, maintained the carbon balance of individual plants, and promoted the growth and development of the C. pilosula roots. In terms of the seed yield of C. pilosula, it was ranked as H2>H1>H3>CK. To be specific, H1 increased by 213.41% compared with CK, H2 increased by 282.43% compared with CK, and H3 increased by 133.95% compared with CK. The yield and quality of C. pilosula were the highest in the H3 treatment group, with the fresh yield of 6 858.33 kg·hm~(-2), 50.59% higher than CK, dry yield of 2 398.33 kg·hm~(-2), 76.54% higher than CK, and lobetyolin content of 0.56 mg·g~(-1), 45.22% higher than CK. Therefore, the stereoscopic traction height has a great influence on the photosynthetic characteristics, yield, and quality of C. pilosula. Particularly, the yield and quality of C. pilosula can be optimized and improved in the traction height treatment of H3(120 cm). This planting method is worth popularizing and applying in the cultivated management of C. pilosula.

Application of high-speed counter current chromatography in extraction and separation of alkaloids in natural products / 中国中药杂志

Alkaloids, widespread in plants, have a series of pharmacological activities and have been widely used to treat various diseases. Because alkaloids are usually presented in multicomponent mixtures and are deeply low in content, they are very difficult to extract and separate by traditional methods. High-speed counter current chromatography(HSCCC) is a kind of liquid-liquid chromatography without solid support phase, which has the advantages of large injection volume, low cost, and no irreversible adsorption. Compared with the traditional methods of extraction and separation of alkaloids, HSCCC can ensure the separation of many different alkaloids at one time, with a high recovery and large amount. In this paper, the advantages and disadvantages of HSCCC compared with traditional separation methods were discussed and the solvent system and elution mode of HSCCC used to separate alkaloids in recent years were summarized by referring to the relevant literature to provide some references for the separation of alkaloids by HSCCC.

Neonatal systemic pseudohypoaldosteronism type I / 中国当代儿科杂志

An 18-day-old male infant was admitted to the hospital due to recurrent hyperkalemia for more than 10 days. The neonate had milk refusal and dyspnea. The blood gas analysis revealed recurrent hyperkalemia, hyponatremia and metabolic acidosis. Adrenocortical hormone replacement therapy was ineffective. Additional tests showed a significant increase in aldosterone levels. Family whole exome sequencing revealed that the infant had compound heterozygous in the SCNNIA gene, inherited from both parents. The infant was diagnosed with neonatal systemic pseudohypoaldosteronism type I. The infant's electrolyte levels were stabilized through treatment with sodium polystyrene sulfonate and sodium supplement. The infant was discharged upon clinical recovery. This study provides a focused description of differential diagnosis of salt-losing syndrome in infants and introduces the multidisciplinary management of neonatal systemic pseudohypoaldosteronism type I.

Effect of procalcitonin on lipopolysaccharide-induced expression of nucleotide-binding oligomerization domain-like receptor protein 3 and caspase-1 in human umbilical vein endothelial cells / 中国当代儿科杂志

OBJECTIVES@#To study the effect of procalcitonin (PCT) on lipopolysaccharide (LPS)-induced expression of the pyroptosis-related proteins nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3) and caspase-1 in human umbilical vein endothelial cells (HUVECs).@*METHODS@#HUVECs were induced by LPS to establish a model of sepsis-induced inflammatory endothelial cell injury. The experiment was divided into two parts. In the first part, HUVECs were randomly divided into four groups: normal control, LPS (1 μg/mL), PCT (10 ng/mL), and LPS+PCT (n=3 each). In the second part, HUVECs were randomly grouped: normal control, LPS, and LPS+PCT of different concentrations (0.1, 1, 10, and 100 ng/mL) (n=3 each). Quantitative real-time PCR and Western blot were used to measure the mRNA and protein expression levels of NLRP3 and caspase-1 in each group.@*RESULTS@#In the first experiment: compared with the normal control group, the PCT, LPS, and LPS+PCT groups had significantly upregulated mRNA and protein expression levels of NLRP3 and caspase-1 (P<0.05); compared with the LPS group, the LPS+PCT group had significantly downregulated mRNA and protein expression levels of NLRP3 and caspase-1 (P<0.05). In the second experiment: compared with those in the LPS group, the mRNA and protein expression levels of NLRP3 and caspase-1 in the LPS+PCT of different concentrations groups were significantly downregulated in a concentration-dependent manner (P<0.05).@*CONCLUSIONS@#LPS can promote the expression of the pyroptosis-related proteins NLRP3 and caspase-1 in HUVECs, while PCT can inhibit the LPS-induced expression of the pyroptosis-related proteins NLRP3 and caspase-1 in HUVECs in a concentration-dependent manner.

Genetic analysis of a Chinese pedigree with 6q26q27 microduplication and 15q26.3 microdeletion / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic basis for a Chinese pedigree with 6q26q27 microduplication and 15q26.3 microdeletion.@*METHODS@#A fetus with a 6q26q27 microduplication and a 15q26.3 microdeletion diagnosed at the First Affiliated Hospital of Wenzhou Medical University in January 2021 and members of its pedigree were selected as the study subject. Clinical data of the fetus was collected. The fetus and its parents were analyzed by G-banding karyotyping and chromosomal microarray analysis (CMA), and its maternal grandparents were also subjected to G-banding karyotype analysis.@*RESULTS@#Prenatal ultrasound had indicated intrauterine growth retardation of the fetus, though no karyotypic abnormality was found with the amniotic fluid sample and blood samples from its pedigree members. CMA revealed that the fetus has carried a 6.6 Mb microduplication in 6q26q27 and a 1.9 Mb microdeletion in 15q26.3, and his mother also carried a 6.49 duplication and a 1.867 deletion in the same region. No anomaly was found with its father.@*CONCLUSION@#The 6q26q27 microduplication and 15q26.3 microdeletion probably underlay the intrauterine growth retardation in this fetus.

Traditional application and modern research progress on new foreign medicinal resources / 中国中药杂志

Chinese medicinal resources are the material basis for the survival and development of traditional Chinese medicine(TCM)and the sustainable development of Chinese medicinal resources is also an important project for the modernization of TCM in China. With the increasing demand for Chinese medicinal resources in China, over-exploitation has destroyed Chinese medicinal resources, resulting in a shortage of many natural medicinal resources in China and making the sustainable development of TCM in trouble. The introduced new foreign medicinal resources have become effective supplement and replacement for Chinese medicinal resources to some extent. However, the development and utilization of new foreign medicinal resources in China are different. To fully understand the development of new foreign medicinal resources in China, this paper, taking 43 new foreign medicinal resources such as Acacia nilotica as objects, sorted out the introduction forms and policies of new foreign medicinal resources, overviewed its current development status in China, summarized the application experience of new foreign medicinal resources in the place of origin, as well as the research progress and problems of new foreign medicinal resources in China and abroad, and analyzed the research situation, which can enrich Chinese medicinal resources and other uses, promote the sustainable development of Chinese medicinal resources, and provide ideas for further development and research of new foreign medicinal resources.

A novel method for electroencephalography background analysis in neonates with hypoxic-ischemic encephalopathy / 中国当代儿科杂志

OBJECTIVES@#To explore a new method for electroencephalography (EEG) background analysis in neonates with hypoxic-ischemic encephalopathy (HIE) and its relationship with clinical grading and head magnetic resonance imaging (MRI) grading.@*METHODS@#A retrospective analysis was performed for the video electroencephalography (vEEG) and amplitude-integrated electroencephalography (aEEG) monitoring data within 24 hours after birth of neonates diagnosed with HIE from January 2016 to August 2022. All items of EEG background analysis were enrolled into an assessment system and were scored according to severity to obtain the total EEG score. The correlations of total EEG score with total MRI score and total Sarnat score (TSS, used to evaluate clinical gradings) were analyzed by Spearman correlation analysis. The total EEG score was compared among the neonates with different clinical gradings and among the neonates with different head MRI gradings. The receiver operating characteristic (ROC) curve and the area under thecurve (AUC) were used to evaluate the value of total EEG score in diagnosing moderate/severe head MRI abnormalities and clinical moderate/severe HIE, which was then compared with the aEEG grading method.@*RESULTS@#A total of 50 neonates with HIE were included. The total EEG score was positively correlated with the total head MRI score and TSS (rs=0.840 and 0.611 respectively, P<0.001). There were significant differences in the total EEG score between different clinical grading groups and different head MRI grading groups (P<0.05). The total EEG score and the aEEG grading method had an AUC of 0.936 and 0.617 respectively in judging moderate/severe head MRI abnormalities (P<0.01) and an AUC of 0.887 and 0.796 respectively in judging clinical moderate/severe HIE (P>0.05). The total EEG scores of ≤6 points, 7-13 points, and ≥14 points were defined as mild, moderate, and severe EEG abnormalities respectively, which had the best consistency with clinical grading and head MRI grading (P<0.05).@*CONCLUSIONS@#The new EEG background scoring method can quantitatively reflect the severity of brain injury and can be used for the judgment of brain function in neonates with HIE.

Genetic analysis of two Chinese pedigrees affected with Hereditary hypofibrinemia due to missense variants / 中华医学遗传学杂志

OBJECTIVE@#To retrospectively analyze the clinical phenotypes and genetic variants in two Chinese pedigrees affected with Hereditary hypofibrinemia (IFD) and explore their molecular pathogenesis.@*METHODS@#Two probands and their pedigree members were admitted to the First Affiliated Hospital of Wenzhou Medical University on March 30, 2021 and May 27, 2021, respectively. Clinical phenotypes of the probands were collected, and blood clotting indexes of the probands and their pedigree members were determined. Variants of the FGA, FGB and FGG genes were analyzed by Sanger sequencing, and candidate variants were verified by sequence comparison. Bioinformatic software was used to analyze the conservation of the amino acids and pathogenicity of the proteins. Alteration in protein structure and intermolecular force before and after the variant was analyzed by simulating the protein model.@*RESULTS@#Proband 1, a 18-year-old male, had significantly low plasma fibrinogen activity (Fg:C) and plasma fibrinogen antigen (Fg:Ag), respectively at 0.80 g/L and 1.00 g/L. Proband 2, a 43-year-old male, had slightly low Fg:C and Fg:Ag at 1.35 g/L and 1.30 g/L, respectively. The Fg:C and Fg:Ag of proband 1's father, proband 2's father and son were also below the normal level. Genetic testing showed that proband 1 had harbored a heterozygous missense variant of c.688T>G (p.Phe230Val) in exon 7 of the FGG gene, which was inherited from his father. Proband 2, his father and son all had harbored a heterozygous variant of c.2516A>C (p.Asn839Thr) in exon 6 of the FGA gene. Homology analysis showed that the Phe230 and Asn839 residues were highly conserved among homologous species. Bioinformatic analysis predicted that both p.Phe230Val and p.Asn839Thr were pathogenic variants.@*CONCLUSION@#Analysis of protein simulation model showed that the p.Asn839Thr variant has changed the hydrogen bo`nd between the amino acids, thus affecting the stability of the protein structure. The heterozygous missense variants of p.Phe230Val and p.Asn839Thr probably underlay the IFD in the two pedigrees.

The rules of acupoint selection of acupuncture and moxibustion for scrofula in ancient times / 中国针灸

Based on data mining technology, the rules of acupoint selection of acupuncture-moxibustion for scrofula in ancient times were analyzed. The relevant articles of acupuncture and moxibustion for scrofula were searched in the Chinese Medical Code, and the original article, acupoint name, acupoint characteristic, and acupoint meridian tropism, etc. were screened and extracted. The Microsoft Excel 2019 was used to establish a acupoint prescription database, and the frequency of acupoints as well as their meridian tropism and characteristics were analyzed. The SPSS21.0 was applied to perform cluster analysis of acupuncture prescriptions; the SPSS Modeler 18.0 was used to perform the association rules analysis of the neck and the chest-armpit acupoints, respectively. As a result, 314 acupuncture prescriptions were extracted, including 236 single-acupoint prescriptions and 78 multiple-acupoints prescriptions (53 for neck and 25 for chest-armpit). A total of 54 acupoints were involved, with a total frequency of 530. The top 3 commonly-used acupoints were Tianjing (TE 10), Zulinqi (GB 41) and Taichong (LR 3); the most commonly-used meridians were hand shaoyang meridian, foot shaoyang meridian, hand yangming meridian and foot yangming meridian; the most commonly-used special acupoints were he-sea points and shu-stream points. The cluster analysis obtained 6 clusters, and the association rule analysis obtained that the core prescriptions of the neck were Quchi (LI 11), Jianyu (LI 15), Tianjing (TE 10) and Jianjing (GB 21), while the core prescriptions of the chest-armpit were Daling (PC 7), Yanglingquan (GB 34), Danzhong (CV 17), Jianjing (GB 21), Waiguan (TE 5), Zhigou (TE 6), Yuanye (GB 22) and Zhangmen (LR 13). The core prescriptions obtained from association rule analysis by difference areas were basically consistent with those by cluster analysis of total prescriptions.

Efficiency and safety analysis of Plerixafor combined with granulocyte colony-stimulating factor on autologous hematopoietic stem cell mobilization in lymphoma / 中华血液学杂志

Objective: To evaluate the advantages and safety of Plerixafor in combination with granulocyte colony-stimulating factor (G-CSF) in autologous hematopoietic stem cell mobilization of lymphoma. Methods: Lymphoma patients who received autologous hematopoietic stem cell mobilization with Plerixafor in combination with G-CSF or G-CSF alone were obtained. The clinical data, the success rate of stem cell collection, hematopoietic reconstitution, and treatment-related adverse reactions between the two groups were evaluated retrospectively. Results: A total of 184 lymphoma patients were included in this analysis, including 115 cases of diffuse large B-cell lymphoma (62.5%) , 16 cases of classical Hodgkin's lymphoma (8.7%) , 11 cases of follicular non-Hodgkin's lymphoma (6.0%) , 10 cases of angioimmunoblastic T-cell lymphoma (5.4%) , 6 cases of mantle cell lymphoma (3.3%) , and 6 cases of anaplastic large cell lymphoma (3.3%) , 6 cases of NK/T-cell lymphoma (3.3%) , 4 cases of Burkitt's lymphoma (2.2%) , 8 cases of other types of B-cell lymphoma (4.3%) , and 2 cases of other types of T-cell lymphoma (1.1%) ; 31 patients had received radiotherapy (16.8%) . The patients in the two groups were recruited with Plerixafor in combination with G-CSF or G-CSF alone. The baseline clinical characteristics of the two groups were basically similar. The patients in the Plerixafor in combination with the G-CSF mobilization group were older, and the number of recurrences and third-line chemotherapy was higher. 100 patients were mobilized with G-CSF alone. The success rate of the collection was 74.0% for one day and 89.0% for two days. 84 patients in the group of Plerixafor combined with G-CSF were recruited successfully with 85.7% for one day and 97.6% for two days. The success rate of mobilization in the group of Plerixafor combined with G-CSF was substantially higher than that in the group of G-CSF alone (P=0.023) . The median number of CD34(+) cells obtained in the mobilization group of Plerixafor combined with G-CSF was 3.9×10(6)/kg. The median number of CD34(+) cells obtained in the G-CSF Mobilization group alone was 3.2×10(6)/kg. The number of CD34(+) cells collected by Plerixafor combined with G-CSF was considerably higher than that in G-CSF alone (P=0.001) . The prevalent adverse reactions in the group of Plerixafor combined with G-CSF were grade 1-2 gastrointestinal reactions (31.2%) and local skin redness (2.4%) . Conclusion: The success rate of autologous hematopoietic stem cell mobilization in lymphoma patients treated with Plerixafor combined with G-CSF is significantly high. The success rate of collection and the absolute count of CD34(+) stem cells were substantially higher than those in the group treated with G-CSF alone. Even in older patients, second-line collection, recurrence, or multiple chemotherapies, the combined mobilization method also has a high success rate of mobilization.

Comparison of the predictive value of Padua and the IMPEDE assessment scores for venous thromboembolism in patients with newly diagnosed multiple myeloma: A single institution experience / 中华血液学杂志

Objective: To compare the predictive efficacy of the two thrombosis risk assessment scores (Padua and IMPEDE scores) in venous thromboembolism (VTE) within 6 months in patients with newly diagnosed multiple myeloma (NDMM) in China. Methods: This study reviewed the clinical data of 421 patients with NDMM hospitalized in Beijing Jishuitan Hospital from April 2014 to February 2022. The sensitivity, specificity, accuracy, and Youden index of the two scores were calculated to quantify the thrombus risk assessment of VTE by the Padua and IMPEDE scores. The receiver operating characteristics curves of the two evaluation scores were drawn. Results: The incidence of VTE was 14.73%. The sensitivity, specificity, accuracy, and Youden index of the Padua score were 100%, 0%, 14.7%, and 0% and that of the IMPEDE score was 79%, 44%, 49.2%, and 23%, respectively. The areas under the curve of Padua and IMPEDE risk assessment scores were 0.591 and 0.722, respectively. Conclusion: IMPEDE score is suitable for predicting VTE within 6 months in patients with NDMM.

To explore the quality markers of Huangqin Qingre Chubi capsule in the treatment of rheumatoid arthritis based on network pharmacology combined with pharmacokinetics and target verification / 药学学报

As an effective prescription for the treatment of rheumatoid arthritis (RA), Huangqin Qingre Chubi capsule (HQC) is still blank in quality control. This study aims to explore quality markers (Q-markers) for HQC in the treatment of RA by integrating network pharmacology and pharmacokinetics. By constructing the visualization network of "pharmacodynamic ingredient-target-pathway", the potential Q-Marker of HQC treatment for RA was preliminatively predicted. A rat model of rheumatic heat obstruction syndrome collagene-induced arthritis (CIA) was established to elucidate the dynamic quantification law of pharmacodynamic components of HQC in the disease state of rats. To establish the inflammatory model of RA synovial fibroblasts (MH7A) induced by tumor necrosis factor-α (TNF-α) in vitro. The effects of active ingredients on protein expression of sphingosin kinase-1 (Sphk1) and p-SphK1 were detected. The network pharmacological results showed that baicalin, geniposide, luteolin, coixol and amygdalin were the important active components of HQC treatment for RA. Quantitative analysis results further verified the measurability of these five components. The expression of Sphk1 and p-SphK1 was significantly inhibited by geniposide and baicalin by Western blotting. The above studies determined that the above 5 components could be used as Q-markers in the treatment of RA by HQC. This experiment was approved by the Experimental Animal Ethics Committee of Anhui University of Chinese Medicine (approval number: AHUCM-rats-2021049). All procedures were conducted in strict accordance with the principles of animal use and care.